Rodzinny zespół raka trzustki i czerniaka z mutacją w genie supresorowym CDKN2 ad

Jedyną tkanką dostępną od Temat II-2 była transdodenalna próbka z biopsji cienkoigłowej gruczolakoraka trzustki, dla której komórkowość nowotworową oszacowano na 40 procent. W przypadku podmiotu III-2 dostępne były dwie próbki biopsyjne średnio zróżnicowanego gruczolakoraka trzustki. Komórkę nowotworową guza oszacowano na zaledwie 5 procent w jednej z próbek i na 50 procent w drugiej. Okazało się, że próbka biopsyjna z Podmiotu III-3 zawiera około 30 procent komórek nowotworowych. DNA przygotowany z archiwalnych próbek tkanek nowotworowych reprezentował mieszaninę normalnego komórkowego (konstytucyjnego) DNA i DNA komórki rakowej. Na podstawie zawartości komórek nowotworowych w każdej z próbek, konstytucyjne DNA stanowiło około 60 procent próbki z Tematu II-2, 95 procent jednego z osobników z Tematu III-2, i 70 procent z okaz z tematu III-3. Tak więc, w próbkach tkanek istniał wystarczający DNA konstytucyjny, aby umożliwić nam zbadanie genu CDKN2 linii zarodkowej u członków rodziny. Niska komórka nowotworowa dostępnych próbek tkanek nowotworowych sprawiła, że badania nad utratą heterozygotyczności i poszukiwaniem specyficznych dla guza mutacji CDKN2 były niepraktyczne. Żadne próbki tkanek nie były dostępne od Tematu I-1, I-2 ani III-1. Badany II-1 zdecydował się nie brać udziału w badaniu. DNA ekstrahowano z próbek krwi obwodowej z Podklas III-4, IV-1, IV-2 i IV-3,9 DNA od członków rodziny oceniano pod kątem zmian w CDKN2 za pomocą konformacji pojedynczej nici konformacyjnej (SSCV) i analizy sekwencji DNA. Startery i warunki stosowane do analizy SSCV były jak opisano wcześniej, 10,11 z następującą modyfikacją. W przypadku amplikonu B egzonu 2 opracowano nowe startery w celu poprawy wiarygodności testu reakcji łańcuchowej polimerazy (PCR). Przedni starter to 5 AACTGCGCCGACCCCGCCACT3 , a starterem do reakcji do tyłu był 5 TCAGCCAGGTCCACGGGCAGA3 . Warianty prążków wycięto z wysuszonych żeli SSCV, ponownie amplifikowano i bezpośrednio zsekwencjonowano.11 Sekwencjonowanie przeprowadzono na obu niciach DNA (sensownej i antysensownej) i wszystkie reakcje powtórzono co najmniej dwa razy. Dla wszystkich badanych członków rodziny przeprowadzono sekwencjonowanie DNA dla amplikonu B eksonu 2.
Badania genotypowania DNA Markera
Znaczniki powtórzenia mikrosatelitarnego (CA) n w D9S157 i D9S171 flankującego locus CDKN2 zostały wpisane dla wszystkich członków pokrewieństwa, jak opisano wcześniej.11
Wyniki
Rysunek 2. Rysunek 2. Sekwencja CDKN2 w konstytucyjnym DNA Probanda. Normalna sekwencja w kodonie 93 – GGG (Gly) – jest pokazana na lewym panelu, a sekwencja związana z chorobą w pokrewnym – TGG (Trp) – jest pokazana w prawym panelu. Strzałka wskazuje przejście G . T w kodonie 93.
Wariant SSCV zidentyfikowano w eksonie 2 (amplikon B) genu CDKN2 w konstytucyjnym DNA probanda (Temat IV-1). Bezpośrednie sekwencjonowanie wariantu ujawniło zmianę nukleotydową G . T w pozycji 295, co spowodowało substytucję reszty tryptofanu dla glicyny w pozycji aminokwasowej 93 (Gly93Trp) (Figura 2). Analiza sekwencji amplifikowanego PCR genu CDKN2 od trzech dodatkowych członków rodziny (osobnicy II-2, III-2 i III-3), którzy wszyscy zmarli na raka trzustki, wykazali, że oni również mieli mutację Gly93Trp
[hasła pokrewne: lista alergenów, złamanie podudzia, neurolog siedlce ]

Powiązane tematy z artykułem: lista alergenów neurolog siedlce złamanie podudzia